Antibody-oligonucleotide conjugates are required in a number of expanding applications, particularly in single cell multiomics where extensive data sets can be generated at the molecular level from a single cell. Cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq) combines scRNA-Seq and Proteomics in one application, to quantify RNA and protein at the same time. This page, along with our TotalSeq™ eBook, explores the capabilities of custom antibody-oligo conjugations and their applications.


TotalSeq™ format antibodies are BioLegend’s proprietary patent pending technology. Contact us if you are interested in partnering with us around this technology.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform

 

 

 

The TotalSeq product suite solution for comprehensive analysis of cellular processes

Our first reagent for proteogenomics applications, TotalSeq™-A oligonucleotide-antibody conjugates, was designed for use with multiple single-cell sequencing platforms that rely on Poly-dT oligonucleotides as mRNA capture method (scRNA-seq). The antibodies integrate in the scRNA-seq workflow as by mimicking a natural mRNA, thanks to the poly-A oligonucleotide embedded in the sequence of the conjugated oligonucleotide. This constitute the capture portion of the oligonucleotide, which also contains a barcode that permanently labels a specific clone, and a PCR handle, which makes the conjugate compatible with Illumina® sequencing reagents and instruments.


We are also now working with compatible partners, and supporting new versions of genomics reagents and solutions, such as the Feature Barcoding technology from 10X Genomics. We now offer our TotalSeq™-B reagents, which are compatible with the Chromium Single Cell Gene Expression Solution (v3)


In addition, as the need to characterize complex systems grows, including specific immune response to pathogens and cancer for example, the study of cell types involved in mounting an adaptive immune response is imperative. To that end, single-cell analysis of T and B cells has increased as these key players will largely define the balance between health and disease. To support research in this field, BioLegend has expanded the TotalSeq™ suite and released compatible conjugates under the name TotalSeq™-C. These antibodies are compatible with the Chromium Single Cell Immune Profiling Solution.   

 

 

  TotalSeq™-A TotalSeq™-B TotalSeq™-C
10x Genomics compatibility Single Cell Gene Expression Solution (3’, v2 and v3) and any system employing the poly-A tail capture method Single Cell Gene Expression Solution (3’, v3) with Feature Barcoding Technology and 10x Genomics Data Analysis Software1 Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software1
PCR handle CCTTGGCACCCGAGAATTCCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN2 CGGAGATGTGTATAAGAGACAGNNNNNNNNNN
Capture sequence Poly-A [(A)30*A*A3] NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A NNNNNNNNNCCCATATAAGA*A*A
Next Generation Sequencing compatibility Compatible with Illumina instruments Compatible with Illumina instruments Compatible with Illumina instruments

 

Notes:

  1. 10x Genomics Data Analysis Software does not support cell hashing analysis.
  2. N represents either randomly selected A, C, G, or T.
  3. These sequences are unique to the TotalSeq™-B and C conjugates, and were developed independently of the reagents used by researchers at the New York Genome Center (NYGC, CITE-seq.com). All Totalseq™-B, C, and the NYGC antibodies are compatible with 10X Genomics solutions. However, protocols and additional reagents such as required primers may be different. Please follow our protocols when using TotalSeq™ reagents.
  4. The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.

Currently, products are guaranteed for 4 months. As we continue to work with this product line, guarantee time will be extended in the future.

Barcodes are placed between the PCR handle and the 3' flanking sequence, and they are clone-specific. 10x Genomics Solutions compatible with TotalSeq™-B and TotalSeq™-C contain all the necessary reagents to process and amplify the oligos derived from BioLegend's products for subsequent Illumina sequencing, meaning there is material to accommodate both RNA and antibody-derived tags (ADT) libraries. 

For TotalSeq™-A use on the Single Cell Gene Expression Solution, v2 and v3 Kits, additional reagents for preparation of ADT libraries must be purchased. Please refer to our protocols (General TotalSeq™ and Hashtags) for a detailed reagent list.

 

The tables below contains barcodes for products available to purchase. Tables will be updated weekly. Last updated 11/08/2019.

TotalSeq™-A

 

Download as Excel document:
Category Cat No. Clone Specificity Reactivity Barcode Sequence
TotalSeq™-A 100569 RM4-5 CD4 Mouse 0001 AACAAGACCCTTGAG
TotalSeq™-A 100773 53-6.7 CD8a Mouse 0002 TACCCGTAATAGCGT
TotalSeq™-A 119729 RMT3-23 CD366 (Tim-3) Mouse 0003 ATTGGCACTCAGATG
TotalSeq™-A 109123 RMP1-30 CD279 (PD-1) Mouse 0004 GAAAGTCAAAGCACT
TotalSeq™-A 305239 2D10 CD80 Human 0005 ACGAATCAATCTGTG
TotalSeq™-A 305443 IT2.2 CD86 Human 0006 GTCTTTGTCAGTGCA
TotalSeq™-A 329743 29E.2A3 CD274 (B7-H1, PD-L1) Human 0007 GTTGTCCGACAATAC
TotalSeq™-A 329619 24F.10C12 CD273 (B7-DC, PD-L2) Human 0008 TCAACGCTTGGCTAG
TotalSeq™-A 309413 2D3 CD275 (B7-H2, ICOSL) Human 0009 GTGCATTCAACAGTA
TotalSeq™-A 331607 DCN.70 CD276 (B7-H3) Human 0010 GACTGGGAGGGTATT
TotalSeq™-A 105843 2B8 CD117 (c-Kit) Mouse 0012 TGCATGTCATCGGTG
TotalSeq™-A 128047 HK1.4 Ly-6C Mouse 0013 AAGTCGTGAGGCATG
TotalSeq™-A 101265 M1/70 CD11b Mouse, Human 0014 TGAAGGCTCATTTGT
TotalSeq™-A 127655 1A8 Ly-6G Mouse 0015 ACATTGACGCAACTA
TotalSeq™-A 318813 122 CD270 (HVEM, TR2) Human 0020 TGATAGAAACAGACC
TotalSeq™-A 311509 5F4 CD137L (4-1BB Ligand) Human 0022 ATTCGCCTTACGCAA
TotalSeq™-A 337623 SKII.4 CD155 (PVR) Human 0023 ATCACATCGTTGCCA
TotalSeq™-A 337417 TX31 CD112 (Nectin-2) Human 0024 AACCTTCCGTCTAAG
TotalSeq™-A 323129 CC2C6 CD47 Human 0026 GCATTCTGTCACCTA
TotalSeq™-A 355117 113-16 CD70 Human 0027 CGCGAACATAAGAAG
TotalSeq™-A 333913 BY88 CD30 Human 0028 TCAGGGTGTGCTGTA
TotalSeq™-A 336709 BJ40 CD48 Human 0029 CTACGACGTAGAAGA
TotalSeq™-A 334346 5C3 CD40 Human 0031 CTCAGATGGAGTATG
TotalSeq™-A 310843 24-31 CD154 Human 0032 GCTAGATAGATGCAA
TotalSeq™-A 316017 HI186 CD52 Human 0033 CTTTGTACGAGCAAA
TotalSeq™-A 300475 UCHT1 CD3 Human 0034 CTCATTGTAACTCCT
TotalSeq™-A 344649 SK3 CD4 Human 0045 GAGGTTAGTGATGGA
TotalSeq™-A 344751 SK1 CD8 Human 0046 GCGCAACTTGATGAT
TotalSeq™-A 362557 5.1H11 CD56 (NCAM) Human 0047 TCCTTTCCTGATAGG
TotalSeq™-A 368543 2D1 CD45 Human 0048 TCCCTTGCGATTTAC
TotalSeq™-A 344847 SK7 CD3 Human 0049 TATCCCTTGGGATGG
TotalSeq™-A 302259 HIB19 CD19 Human 0050 CTGGGCAATTACTCG
TotalSeq™-A 367131 63D3 CD14 Human 0051 CAATCAGACCTATGA
TotalSeq™-A 366629 P67.6 CD33 Human 0052 TAACTCAGGGCCTAT
TotalSeq™-A 371519 S-HCL-3 CD11c Human 0053 TACGCCTATAACTTG
TotalSeq™-A 343537 581 CD34 Human 0054 GCAGAAATCTCCCTT
TotalSeq™-A 356533 MI15 CD138 (Syndecan-1) Human 0055 ACTCTTTCGTTTACG
TotalSeq™-A 357521 19F2 CD269 (BCMA) Human 0056 CAGATGATCCACCAT
TotalSeq™-A 316321 2M2 β2-microglobulin Human 0057 CAGCCCGATTAAGGT
TotalSeq™-A 311445 W6/32 HLA-A,B,C Human 0058 TATGCGAGGCTTATC
TotalSeq™-A 328135 5E10 CD90 (Thy1) Human 0060 GCATTGTACGATTCA
TotalSeq™-A 313241 104D2 CD117 (c-kit) Human 0061 AGACTAATAGCTGAC
TotalSeq™-A 312231 HI10a CD10 Human 0062 CAGCCATTCATTAGG
TotalSeq™-A 304157 HI100 CD45RA Human 0063 TCAATCCTTCCGCTT
TotalSeq™-A 306037 6H6 CD123 Human 0064 CTTCACTCTGTCAGG
TotalSeq™-A 343123 CD7-6B7 CD7 Human 0066 TGGATTCCCGGACTT
TotalSeq™-A 323221 43A3 CD105 Human 0068 ATCGTCGAGAGCTAG
TotalSeq™-A 351907 RCR-401 CD201 (EPCR) Human 0069 GTTTCCTTGACCAAG
TotalSeq™-A 313633 GoH3 CD49f Human 0070 TTCCGAGGATGATCT
TotalSeq™-A 359423 L291H4 CD194 (CCR4) Human 0071 AGCTTACCTGCACGA
TotalSeq™-A 300563 RPA-T4 CD4 Human 0072 TGTTCCCGCTCAACT
TotalSeq™-A 103045 IM7 CD44 Mouse, Human 0073 TGGCTTCAGGTCCTA
TotalSeq™-A 116127 YN1/1.7.4 CD54 Mouse 0074 ATAACCGACACAGTG
TotalSeq™-A 105345 30-H12 CD90.2 Mouse 0075 CCGATCAGCCGTTTA
TotalSeq™-A 125615 MC-480 CD15 (SSEA-1) Mouse 0076 GCTAGTTTGTGCTGC
TotalSeq™-A 127227 TY/11.8 CD73 Mouse 0077 ACACTTAACGTCTGG
TotalSeq™-A 103623 R1-2 CD49d Mouse 0078 CGCTTGGACGCTTAA
TotalSeq™-A 123811 OX-90 CD200 (OX2) mouse 0079 TCAATTCCGGTAGTC
TotalSeq™-A 301067 RPA-T8 CD8a Human 0080 GCTGCGCTTTCCATT
TotalSeq™-A 301855 M5E2 CD14 Human 0081 TCTCAGACCTCCGTA
TotalSeq™-A 302061 3G8 CD16 Human 0083 AAGTTCACTCTTTGC
TotalSeq™-A 392421 QA17A16 CD56 (NCAM) Human 0084 TTCGCCGCATTGAGT
TotalSeq™-A 302643 BC96 CD25 Human 0085 TTTGTCCTGTACGCC
TotalSeq™-A 304255 UCHL1 CD45RO Human 0087 CTCCGAATCATGTTG
TotalSeq™-A 329955 EH12.2H7 CD279 (PD-1) Human 0088 ACAGCGCCGTATTTA
TotalSeq™-A 372725 A15153G TIGIT (VSTM3) Human 0089 TTGCTTACCGCCAGA
TotalSeq™-A 400199 MOPC-21 N/A N/A 0090 GCCGGACGACATTAA
TotalSeq™-A 400285 MOPC-173 N/A N/A 0091 CTCCTACCTAAACTG
TotalSeq™-A 400373 MPC-11 N/A N/A 0092 ATATGTATCACGCGA
TotalSeq™-A 115559 6D5 CD19 Mouse 0093 ATCAGCCATGTCAGT
TotalSeq™-A 400673 RTK4530 N/A N/A 0095 GATTCTTGACGACCT
TotalSeq™-A 103159 30-F11 CD45 Mouse 0096 TGGCTATGGAGCAGA
TotalSeq™-A 102055 PC61 CD25 Mouse 0097 ACCATGAGACACAGT
TotalSeq™-A 135316 A2F10 CD135 Mouse 0098 GTAGCAAGATTCAAG
TotalSeq™-A 302359 2H7 CD20 Human 0100 TTCTGGGTCCCTAGA
TotalSeq™-A 331943 9E2 CD335 (NKp46) Human 0101 ACAATTTGAACAGCG
TotalSeq™-A 350127 BM16 CD294 (CRTH2) Human 0102 TGTTTACGAGAGCCC
TotalSeq™-A 103263 RA3-6B2 CD45R/B220 Mouse, Human 0103 CCTACACCTCATAAT
TotalSeq™-A 105613 3C4 (MIC2/4) CD102 Mouse 0104 GATATTCAGTGCGAC
TotalSeq™-A 135533 AFS98 CD115 (CSF-1R) Mouse 0105 TTCCGTTGTTGTGAG
TotalSeq™-A 117355 N418 CD11c Mouse 0106 GTTATGGACGCTTGC
TotalSeq™-A 123427 7E9 CD21/CD35 (CR2/CR1) Mouse 0107 GGATAATTTCGATCC
TotalSeq™-A 101635 B3B4 CD23 Mouse 0108 TCTCTTGGAAGATGA
TotalSeq™-A 101343 93 CD16/32 Mouse 0109 TTCGATGCTGGAGCA
TotalSeq™-A 143211 S11 CD43 Mouse 0110 TTGGAGGGTTGTGCT
TotalSeq™-A 100637 53-7.3 CD5 Mouse 0111 CAGCTCAGTGTGTTG
TotalSeq™-A 104451 MEL-14 CD62L Mouse 0112 TGGGCCTAAGTCATC
TotalSeq™-A 136513 AA4.1 CD93 (AA4.1, early B lineage) Mouse 0113 GGTATTTCCTGTGGT
TotalSeq™-A 123153 BM8 F4/80 Mouse 0114 TTAACTTCAGCCCGT
TotalSeq™-A 134333 MAR-1 FcεRIα Mouse 0115 AGTCACCTCGAAGCT
TotalSeq™-A 108459 RB6-8C5 Ly-6G/Ly-6C (Gr-1) Mouse 0116 TAGTGTATGGACACG
TotalSeq™-A 107653 M5/114.15.2 I-A/I-E Mouse 0117 GGTCACCAGTATGAT
TotalSeq™-A 108755 PK136 NK-1.1 Mouse 0118 GTAACATTACTCGTC
TotalSeq™-A 129615 551 Siglec-H Mouse 0119 CCGCACCTACATTAG
TotalSeq™-A 109247 H57-597 TCR β chain Mouse 0120 TCCTATGGGACTCAG
TotalSeq™-A 118137 GL3 TCR γ/δ Mouse 0121 AACCCAAATAGCTGA
TotalSeq™-A 116247 TER-119 TER-119/Erythroid Cells Mouse 0122 GCGCGTTTGTGCTAT
TotalSeq™-A 324241 9C4 CD326 (EpCAM) Human 0123 TTCCGAGCAAGTATC
TotalSeq™-A 303137 WM59 CD31 Human 0124 ACCTTTATGCCACGG
TotalSeq™-A 338825 BJ18 CD44 Human 0125 AATCCTTCCGAATGT
TotalSeq™-A 372815 clone 7 CD133 Human 0126 TGGTAACGACAGTCC
TotalSeq™-A 337019 NC-08 Podoplanin Human 0127 GGTTACTCGTTGTGT
TotalSeq™-A 323509 16A1 CD140a Human 0128 ATGCGCCGAGAATTA
TotalSeq™-A 323609 18A2 CD140b Human 0129 CAATGGTTCACTGCC
TotalSeq™-A 108147 D7 Ly-6A/E (Sca-1) Mouse 0130 TTCCTTTCCTACGCA
TotalSeq™-A 368715 16G5 Cadherin 11 Human 0131 CGTTGCCATTAACCA
TotalSeq™-A 352923 AY13 EGFR Human 0132 GCTTAACATTGGCAC
TotalSeq™-A 324423 24D2 CD340 (erbB2/HER-2) Human 0133 CTGTAGCCGCCTATT
TotalSeq™-A 361017 P1H12 CD146 Human 0134 CCTTGGATAACATCA
TotalSeq™-A 324125 67A4 CD324 (E-Cadherin) Human 0135 ATCCTTCTCCCTTTC
TotalSeq™-A 314541 MHM-88 IgM Human 0136 TAGCGAGCCCGTATA
TotalSeq™-A 300635 UCHT2 CD5 Human 0138 CATTAACGGGATGCC
TotalSeq™-A 331229 B1 TCR γ/δ Human 0139 CTTCCGATTCATTCA
TotalSeq™-A 353745 G025H7 CD183 (CXCR3) Human 0140 GCGATGGTAGATTAT
TotalSeq™-A 359135 J418F1 CD195 (CCR5) Human 0141 CCAAAGTAAGAGCCA
TotalSeq™-A 303223 FUN-2 CD32 Human 0142 GCTTCCGAATTACCG
TotalSeq™-A 353437 G034E3 CD196 (CCR6) Human 0143 GATCCCTTTGTCACT
TotalSeq™-A 356937 J252D4 CD185 (CXCR5) Human 0144 AATTCAACCGTCGCC
TotalSeq™-A 350231 Ber-ACT8 CD103 Human 0145 GACCTCATTGTGAAT
TotalSeq™-A 310947 FN50 CD69 Human 0146 GTCTCTTGGCTTAAA
TotalSeq™-A 304847 DREG-56 CD62L Human 0147 GTCCCTGCAACTTGA
TotalSeq™-A 353247 G043H7 CD197 (CCR7) Human 0148 AGTTCAGTCAACCGA
TotalSeq™-A 339945 HP-3G10 CD161 Human 0149 GTACGCAGTCCTTCT
TotalSeq™-A 369619 BNI3 CD152 Human 0151 ATGGTTCACGTAATC
TotalSeq™-A 369333 11C3C65 CD223 (LAG-3) Human 0152 CATTTGTCTGCCGGT
TotalSeq™-A 367721 SA231A2 KLRG1 (MAFA) Human 0153 CTTATTTCCTGCCCT
TotalSeq™-A 302847 O323 CD27 Human 0154 GCACTCCTGCATGTA
TotalSeq™-A 328647 H4A3 CD107a (LAMP-1) Human 0155 CAGCCCACTGCAATA
TotalSeq™-A 305649 DX2 CD95 (Fas) Human 0156 CCAGCTCATTAGAGC
TotalSeq™-A 109853 104 CD45.2 Mouse 0157 CACCGTCATTCAACC
TotalSeq™-A 350033 Ber-ACT35 (ACT35) CD134 (OX40) Human 0158 AACCCACCGTTGTTA
TotalSeq™-A 307659 L243 HLA-DR Human 0159 AATAGCGAGCAAGTA
TotalSeq™-A 331539 L161 CD1c Human 0160 GAGCTACTTCACTCG
TotalSeq™-A 301353 ICRF44 CD11b Human 0161 GACAAGTGATCTGCA
TotalSeq™-A 305037 10.1 CD64 Human 0162 AAGTATGCCCTACGA
TotalSeq™-A 344121 M80 CD141 (Thrombomodulin) Human 0163 GGATAACCGCGCTTT
TotalSeq™-A 350317 51.1 CD1d Human 0164 TCGAGTCGCTTATCA
TotalSeq™-A 320835 1D11 CD314 (NKG2D) Human 0165 CGTGTTTGTTCCTCA
TotalSeq™-A 392905 6/40c CD66b Human 0166 AGCTGTAAGTTTCGG
TotalSeq™-A 333407 E11 CD35 Human 0167 ACTTCCGTCGATCTT
TotalSeq™-A 393319 QA17A04 CD57 Human 0168 AACTCCCTATGGAGG
TotalSeq™-A 345047 F38-2E2 CD366 (Tim-3) Human 0169 TGTCCTACCCAACTT
TotalSeq™-A 344525 MIH26 CD272 (BTLA) Human 0170 GTTATTGGACTAAGG
TotalSeq™-A 313555 C398.4A CD278 (ICOS) Human, Mouse 0171 CGCGCACCCATTAAA
TotalSeq™-A 329809 9F.8A4 CD275 (B7-H2, B7-RP1, ICOSL) Human 0172 GTTAGTGTTAGCTTG
TotalSeq™-A 330919 TS2/9 CD58 Human 0174 GTTCCTATGGACGAC
TotalSeq™-A 338419 NK92.39 CD96 (TACTILE) Human 0175 TGGCCTATAAATGGT
TotalSeq™-A 328233 A1 CD39 Human 0176 TTACCTGGTATCCGT
TotalSeq™-A 306413 NOK-1 CD178 (Fas-L) Human 0177 CCGGTCCTCTGTATT
TotalSeq™-A 110753 A20 CD45.1 Mouse 0178 CCTATGGACTTGGAC
TotalSeq™-A 311137 ML5 CD24 Human 0180 AGATTCCTTCGTGTT
TotalSeq™-A 354915 Bu32 CD21 Human 0181 AACCTAGTAGTTCGG
TotalSeq™-A 100251 17A2 CD3 Mouse 0182 GTATGTCCGCTCGAT
TotalSeq™-A 137633 29A1.4 CD335 (NKp46) Mouse 0184 CCCTTTCACCTCGAA
TotalSeq™-A 350615 TS2/4 CD11a Human 0185 TATATCCTTGTGAGC
TotalSeq™-A 341415 CB3-1 CD79b (Igβ) Human 0187 ATTCTTCAACCGAAG
TotalSeq™-A 342319 ASL-32 CD66a/c/e Human 0188 GGGACAGTTCGTTTC
TotalSeq™-A 329527 C1.7 CD244 (2B4) Human 0189 TCGCTTGGATGGTAG
TotalSeq™-A 153604 MIH6 CD274 (B7-H1, PD-L1) Mouse 0190 TCGATTCCACCAACT
TotalSeq™-A 124235 LG.3A10 CD27 Mouse, Human 0191 CAAGGTATGTCACTG
TotalSeq™-A 150423 SA275A11 CD20 Mouse 0192 TCCACTCCCTGTATA
TotalSeq™-A 126319 DTA-1 GITR mouse 0193 GGCACTCTGTAACAT
TotalSeq™-A 106111 17B5 CD137 Mouse 0194 TCCCTGTATAGATGA
TotalSeq™-A 119426 OX-86 CD134 (OX40) Mouse 0195 CTCACCTACCTATGG
TotalSeq™-A 306623 HIR2 CD235ab Human 0196 GCTCCTTTACACGTA
TotalSeq™-A 104546 H1.2F3 CD69 Mouse 0197 TTGTATTCCGCCATT
TotalSeq™-A 135045 A7R34 CD127 (IL-7Rα) Mouse 0198 GTGTGAGGCACTCTT
TotalSeq™-A 105047 GL-1 CD86 Mouse 0200 CTGGATTTGTGTATC
TotalSeq™-A 121437 2E7 CD103 Mouse 0201 TTCATTAGCCCGCTG
TotalSeq™-A 139325 X54-5/7.1 CD64 (FcγRI) Mouse 0202 AGCAATTAACGGGAG
TotalSeq™-A 115945 TC15-12F12.2 CD150 (SLAM) Mouse 0203 CAACGCCTAGAAACC
TotalSeq™-A 321143 15-2 CD206 (MMR) Human 0205 TCAGAACGTCTAACT
TotalSeq™-A 346011 7-239 CD169 (Sialoadhesin, Siglec-1) Human 0206 TACTCAGCGTGTTTG
TotalSeq™-A 353807 8F9 CD370 (CLEC9A/DNGR1) Human 0207 CTGCATTTCAGTAAG
TotalSeq™-A 372613 S15046E XCR1 Human 0208 AAGACGCATGTCAAC
TotalSeq™-A 141113 2.11 TCR Vγ1.1/Cr4 Mouse 0209 TCGTTTAACCAGCCT
TotalSeq™-A 137507 536 TCR Vγ3 Mouse 0210 TCGTGGTCCCTTTCT
TotalSeq™-A 137709 UC3-10A6 TCR Vγ2 Mouse 0211 AAGCTGCACCGTAAT
TotalSeq™-A 101841 M1/69 CD24 Mouse 0212 TATATCTTTGCCGCA
TotalSeq™-A 352109 MHN1-519 Notch 1 Human 0213 AATCTGTAGTGCGTT
TotalSeq™-A 321227 FIB504 Integrin β7 Human 0214 TCCTTGGATGTACCG
TotalSeq™-A 316925 11C1 CD268 (BAFF-R) Human 0215 CGAAGTCGATCCGTA
TotalSeq™-A 303937 HIP1 CD42b Human 0216 TCCTAGTACCGAAGT
TotalSeq™-A 353123 HA58 CD54 Human 0217 CTGATAGACTTGAGT
TotalSeq™-A 304933 AK4 CD62P (P-Selectin) Human 0218 CCTTCCGTATCCCTT
TotalSeq™-A 308607 GIR-208 CD119 (IFN-γ R α chain) Human 0219 TGTGTATTCCCTTGT
TotalSeq™-A 306737 IP26 TCR α/β Human 0224 CGTAACGTAGAGCGA
TotalSeq™-A 129825 29-2L17 CD196 (CCR6) Mouse 0225 CTCTCTGCATTCCTC
TotalSeq™-A 105725 429 (MVCAM.A) CD106 Mouse 0226 CGTTCCTACCTACCT
TotalSeq™-A 126623 YTS156.7.7 CD8b Mouse 0230 TTCCCTCTATGGAGC
TotalSeq™-A 141615 25-D1.16 H-2Kb bound to SIINFEKL Mouse 0231 CGTTTATGGGATGGG
TotalSeq™-A 120713 MECA-367 MAdCAM-1 Mouse 0232 TTGGGCGATTAAGAA
TotalSeq™-A 345411 MHN3-21 Notch 3 Human 0233 CTATTGGACGTATCT
TotalSeq™-A 118415 KJ16-133.18 TCR Vβ8.1, 8.2 Mouse 0235 ACTATCCGTTGTGCT
TotalSeq™-A 400459 RTK2071 N/A N/A 0236 ATCAGATGCCCTCAT
TotalSeq™-A 401919 G0114F7 N/A N/A 0237 GGGAGCGATTCAACT
TotalSeq™-A 400571 RTK2758 N/A N/A 0238 AAGTCAGGTTCGTTT
TotalSeq™-A 400739 RTK4174 N/A N/A 0240 TCCAGGCTAGTCATT
TotalSeq™-A 400973 HTK888 N/A N/A 0241 CCTGTCATTAAGACT
TotalSeq™-A 357229 K036C2 CD192 (CCR2) Human 0242 GAGTTCCCTTACCTG
TotalSeq™-A 328509 CBR-IC2/2 CD102 Human 0244 TGACCTTCCTCTCCT
TotalSeq™-A 305813 STA CD106 Human 0245 TCACAGTTCCTTGGA
TotalSeq™-A 311913 1A1 CD267 (TACI) Human 0247 AGTGATGGAGCGAAC
TotalSeq™-A 336017 HAE-1f CD62E Human 0248 CTCCCTGTGGCTTAA
TotalSeq™-A 138431 2F1/KLRG1 KLRG1 (MAFA) Mouse, Human 0250 GTAGTAGGCTAGACC
TotalSeq™-A 313317 BV10A4H2 CD135 Human 0351 CAGTAGATGGAGCAT
TotalSeq™-A 334641 AER-37 (CRA-1) FcεRIα Human 0352 CTCGTTTCCGTATCG
TotalSeq™-A 303737 HIP8 CD41 Human 0353 ACGTTGTGGCCTTGT
TotalSeq™-A 139517 MR9-4 TCR Vβ5.1, 5.2 Mouse 0354 CTCAACAGTATTCTG
TotalSeq™-A 309835 4B4-1 CD137 Human 0355 CAGTAAGTTCGGGAC
TotalSeq™-A 347509 MIH24 CD254 (TRANCE, RANKL) Human 0356 TCCGTGTTAGTTTGT
TotalSeq™-A 343209 CD43-10G7 CD43 Human 0357 GATTAACCAGCTCAT
TotalSeq™-A 333635 GHI/61 CD163 Human 0358 GCTTCTCCTTCCTTA
TotalSeq™-A 305339 HB15e CD83 Human 0359 CCACTCATTTCCGGT
TotalSeq™-A 371225 108-17 CD357 (GITR) Human 0360 ACCTTTCGACACTCG
TotalSeq™-A 304709 p282 (H19) CD59 Human 0361 AATTAGCCGTCGAGA
TotalSeq™-A 359919 7D4-6 CD309 (VEGFR2) Human 0362 TTCACGCAGTAAGAT
TotalSeq™-A 301729 WM15 CD13 Human 0364 TTTCAACGCCCTTTC
TotalSeq™-A 306531 12G5 CD184 (CXCR4) Human 0366 TCAGGTCCTTTCAAC
TotalSeq™-A 309229 TS1/8 CD2 Human 0367 TACGATTTGTCAGGG
TotalSeq™-A 338335 11A8 CD226 (DNAM-1) Human 0368 TCTCAGTGTTTGTGG
TotalSeq™-A 303027 TS2/16 CD29 Human 0369 GTATTCCCTCAGTCA
TotalSeq™-A 354239 201A CD303 (BDCA-2) Human 0370 GAGATGTCCGAATTT
TotalSeq™-A 359311 P1E6-C5 CD49b Human 0371 GCTTTCTTCAGTATG
TotalSeq™-A 336423 VI-PL2 CD61 Human 0372 AGGTTGGAGTAGACT
TotalSeq™-A 349521 5A6 CD81 (TAPA-1) Human 0373 GTATCCTTCCTTGGC
TotalSeq™-A 315605 MEM-108 CD98 Human 0374 GCACCAACAGCCATT
TotalSeq™-A 410725 M1310G05 IgG Fc Human 0375 CTGGAGCGATTAGAA
TotalSeq™-A 107019 HM-CCR5 CD195 (CCR5) Mouse 0376 ACCAGTTGTCATTAC
TotalSeq™-A 125229 C9B7W CD223 (LAG-3) Mouse 0378 ATTCCGTCCCTAAGG
TotalSeq™-A 202547 OX-7 CD90.1 (Thy-1.1) Mouse 0380 AGTATGGGATGCAAT
TotalSeq™-A 120507 MECA-32 Panendothelial Cell Antigen Mouse 0381 CGTCCTAGTCATTGG
TotalSeq™-A 315811 MEM-166 CD177 Human 0382 AGTATGGAGCCATAT
TotalSeq™-A 311317 JS11 CD55 Human 0383 GCTCATTACCCATTA
TotalSeq™-A 348243 IA6-2 IgD Human 0384 CAGTCTCCGTAGAGT
TotalSeq™-A 302121 TS1/18 CD18 Human 0385 TATTGGGACACTTCT
TotalSeq™-A 302955 CD28.2 CD28 Human 0386 TGAGAACGACCCTAA
TotalSeq™-A 322907 1D3 TSLPR (TSLP-R) Human 0387 CAGTCCTCTCTGTCA
TotalSeq™-A 303541 HIT2 CD38 Human 0389 TGTACCCGCTTGTGA
TotalSeq™-A 351352 A019D5 CD127 (IL-7Rα) Human 0390 GTGTGTTGTCCTATG
TotalSeq™-A 304064 HI30 CD45 Human 0391 TGCAATTACCCGGAT
TotalSeq™-A 323046 W6D3 CD15 (SSEA-1) Human 0392 TCACCAGTACCTAGT
TotalSeq™-A 363514 S-HCL-1 CD22 Human 0393 GGGTTGTTGTCTTTG
TotalSeq™-A 334123 CY1G4 CD71 Human 0394 CCGTGTTCCTCATTA
TotalSeq™-A 358114 MIH43 B7-H4 Human 0395 TGTATGTCTGCCTTG
TotalSeq™-A 302720 BA5b CD26 Human 0396 GGTGGCTAGATAATG
TotalSeq™-A 310729 5E8 CD193 (CCR3) Human 0397 ACCAATCCTTTCGTC
TotalSeq™-A 347325 9-4D2-1E4 CD115 (CSF-1R) Human 0398 AATCACGGTCCTTGT
TotalSeq™-A 371909 7C9C20 CD204 Human 0399 TAGCGAGCCAGATGT
TotalSeq™-A 348517 BV9 CD144 (VE-cadherin) Human 0400 TCCACTCATTCTGTA
TotalSeq™-A 354707 H037G3 CD301 (CLEC10A) Human 0401 ACCTAGAAATCAGCA
TotalSeq™-A 300133 HI149 CD1a Human 0402 GATCGTGTTGTGTTA
TotalSeq™-A 352207 10E2 CD207 (Langerin) Human 0403 CATTCTTCACGGGAT
TotalSeq™-A 353035 H5C6 CD63 Human 0404 GAGATGTCTGCAACT
TotalSeq™-A 312817 HTA125 CD284 (TLR4) Human 0405 GCTTAGCTGTATCCG
TotalSeq™-A 354525 12C2 CD304 (Neuropilin-1) Human 0406 GGACTAAGTTTCGTT
TotalSeq™-A 336225 5-271 CD36 Human 0407 TTCTTTGCCTTGCCA
TotalSeq™-A 372109 15-414 CD172a (SIRPα) Human 0408 CGTGTTTAACTTGAG
TotalSeq™-A 326411 17G10.2 CD85g (ILT7) Human 0409 TGTCAGTTCCTATGA
TotalSeq™-A 356635 HB-7 CD38 Human 0410 CCTATTCCGATTCCG
TotalSeq™-A 848009 S16007D P2RY12 Mouse 0415 TTGCTTATTTCCGCA
TotalSeq™-A 147105 ZAQ5 CD300LG (Nepmucin) Mouse 0416 CGGTCCGTATCATTT
TotalSeq™-A 155303 S15049I CD163 Mouse 0417 GAGCAAGATTAAGAC
TotalSeq™-A 919407 4E3.16 CD243 (ABCB1) Human 0418 TGACCCGACCTTTAG
TotalSeq™-A 316205 3F3 CD72 Human 0419 CAGTCGTGGTAGATA
TotalSeq™-A 339515 HP-MA4 CD158 (KIR2DL1/S1/S3/S5) Human 0420 TATCAACCAACGCTT
TotalSeq™-A 103523 HMα2 CD49b Mouse 0421 CGCGTTAGTAGAGTC
TotalSeq™-A 144033 P84 CD172a (SIRPα) Mouse 0422 GATTCCCTTGTAGCA
TotalSeq™-A 367617 590H11G1E3 MERTK Human 0423 TCCTGCATGTACCCA
TotalSeq™-A 123333 Sa14-2 CD14 Mouse 0424 AACCAACAGTCACGT
TotalSeq™-A 150625 SA203G11 CD192 (CCR2) Mouse 0426 AGTGCGATCTGCAAC
TotalSeq™-A 391707 94b/FOLR2 Folate Receptor β (FR-β) Human 0427 TGTGGCTAGTCAGTT
TotalSeq™-A 354009 9F4 Tim-4 Human 0428 CGTCATATAGTATGG
TotalSeq™-A 103447 HM48-1 CD48 Mouse 0429 AGAACCGCCGTAGTT
TotalSeq™-A 371609 L1-OV198.5 CD171 (L1CAM) Human 0430 GATGGACGACAATTC
TotalSeq™-A 800319 3F4 CD230 (Prion) Human 0432 CAGGTCCCTTATTTC
TotalSeq™-A 350817 8C11 CD325 (N-Cadherin) Human 0433 CCTTCCCTTTCCTCT
TotalSeq™-A 409008 1D4-C5 Biotin N/A 0436 CGGTATATCAACAGA
TotalSeq™-A 141509 RCR-16 CD201 (EPCR) Mouse 0439 TATGATCTGCCCTTG
TotalSeq™-A 142425 3D6.112 CD169 (Siglec-1) Mouse 0440 ATTGACGACAGTCAT
TotalSeq™-A 113824 RI7217 CD71 Mouse 0441 ACCGACCAGTAGACA
TotalSeq™-A 130617 HMN1-12 Notch 1 Mouse 0442 TCCGGTCACTCAGTA
TotalSeq™-A 133937 MWReg30 CD41 Mouse 0443 ACTTGGATGGACACT
TotalSeq™-A 146520 L276F12 CD184 (CXCR4) Mouse 0444 GTCGTGGTGTTGTTC
TotalSeq™-A 853303 A16075D TMEM119 (Extracellular) Human 0445 TCGAACATTTCCAGG
TotalSeq™-A 336121 VIMD2 CD93 Human 0446 GCGCTACTTCCTTGA
TotalSeq™-A 154703 1F8C33 CD204 (Msr1) Mouse 0448 AGCTAGACACGTTGT
TotalSeq™-A 118237 G8.8 CD326 (Ep-CAM) Mouse 0449 ACCCGCGTTAGTATG
TotalSeq™-A 406535 RMM-1 IgM Mouse 0450 AGCTACGCATTCAAT
TotalSeq™-A 145611 LOM-8.7 CD301a (MGL1) Mouse 0551 TGTATTTACTCACCG
TotalSeq™-A 145215 3E12 CD304 (Neuropilin-1) Mouse 0552 CCAGCTCATTCAACG
TotalSeq™-A 136415 Avas12 CD309 (VEGFR2, Flk-1) Mouse 0553 ATAAGAGCCCACCAT
TotalSeq™-A 121921 89B3A5 CD309 (VEGFR2, Flk-1) Mouse 0554 AGTTGTCCTGTACGA
TotalSeq™-A 102621 HM36 CD36 Mouse 0555 TTTGCCGCTACGACA
TotalSeq™-A 102733 90 CD38 Mouse 0557 CGTATCCGTCTCCTA
TotalSeq™-A 131809 RIKO-3 CD55 (DAF) Mouse 0558 ATTGTTGTCAGACCA
TotalSeq™-A 143915 NVG-2 CD63 Mouse 0559 ATCCGACACGTATTA
TotalSeq™-A 137031 FA-11 CD68 Mouse 0560 CTTTCTTTCACGGGA
TotalSeq™-A 132811 HM79-12 CD79b (Igβ) Mouse 0561 TAACTCAGTGCGAGT
TotalSeq™-A 121519 Michel-19 CD83 Mouse 0562 TCTCAGGCTTCCTAG
TotalSeq™-A 149041 SA011F11 CX3CR1 Mouse 0563 CACTCTCAGTCCTAT
TotalSeq™-A 153307 10/FR2 Folate Receptor β (FR-β) Mouse 0564 CTCAGATGCCCTTTA
TotalSeq™-A 146817 URA-1 CD301b (MGL2) Mouse 0566 CTTGCCTTGCGATTT
TotalSeq™-A 130011 RMT4-54 Tim-4 Mouse 0567 TGCTGGAGGGTATTC
TotalSeq™-A 148227 ZET XCR1 Mouse 0568 TCCATTACCCACGTT
TotalSeq™-A 332021 5D3 CD338 (ABCG2) Human 0569 TAAGACTTGGCCGTC
TotalSeq™-A 102233 HMβ1-1 CD29 Mouse 0570 ACGCATTCCTTGTGT
TotalSeq™-A 405745 11-26c.2a IgD Mouse 0571 TCATATCCGTTGTCC
TotalSeq™-A 342407 1D9-M12 C5L2 Human 0572 ACAATTTGTCTGCGA
TotalSeq™-A 135917 APA5 CD140a Mouse 0573 GTCATTGCGGTCCTA
TotalSeq™-A 349117 HI264 CD235a (Glycophorin A) Human 0574 AGAGTATGTATGGGA
TotalSeq™-A 328315 TS2/7 CD49a Human 0575 ACTGATGGACTCAGA
TotalSeq™-A 304337 9F10 CD49d Human 0576 CCATTCAACTTCCGG
TotalSeq™-A 344029 AD2 CD73 (Ecto-5'-nucleotidase) Human 0577 CAGTTCCTCAGTTCG
TotalSeq™-A 312119 HI9a CD9 Human 0579 GAGTCACCAATCTGC
TotalSeq™-A 351733 3C10 TCR Vα7.2 Human 0581 TACGAGCAGTATTCA
TotalSeq™-A 331433 B6 TCR Vδ2 Human 0582 TCAGTCAGATGGTAT
TotalSeq™-A 331311 B3 TCR Vγ9 Human 0583 AAGTGATGGTATCTG
TotalSeq™-A 342923 6B11 TCR Vα24-Jα18 (iNKT cell) Human 0584 AACTTCTGTGGTAGC
TotalSeq™-A 334213 33.1 (Ab33) CD202b (Tie2/Tek) Human 0588 CGATCCCTTACCTAT
TotalSeq™-A 342805 NKTA255 CD305 (LAIR1) Human 0590 ATTTCCATTCCCTGT
TotalSeq™-A 358611 15C4 LOX-1 Human 0591 ACCCTTTACCGAATA
TotalSeq™-A 312615 DX27 CD158b (KIR2DL2/L3, NKAT2) Human 0592 GACCCGTAGTTTGAT
TotalSeq™-A 324627 NP4D6 CD203c (E-NPP3) Human 0593 TAACCGTACCTGCAT
TotalSeq™-A 394005 S16016B CD133 Human 0594 GTAAGACGCCTATGC
TotalSeq™-A 101125 M17/4 CD11a Mouse 0595 AGAGTCTCCCTTTAG
TotalSeq™-A 136209 1G8/ESAM ESAM Mouse 0596 TATAGTTTCCGCCGT
TotalSeq™-A 330119 9E9A8 CD209 (DC-SIGN) Human 0597 TCACTGGACACTTAA
TotalSeq™-A 312723 DX9 CD158e1 (KIR3DL1, NKB1) Human 0599 GGACGCTTTCCTTGA
TotalSeq™-A 341307 UP-R1 CD158f (KIR2DL5) Human 0600 AAAGTGATGCCACTG
TotalSeq™-A 325221 P30-15 CD337 (NKp30) Human 0801 AAAGTCACTCTGCCG
TotalSeq™-A 308211 RIK-2 CD253 (TRAIL) Human 0803 GCCATTCCTGCCTAA
TotalSeq™-A 356021 K041E5 CD186 (CXCR6) Human 0804 GACAGTCGATGCAAC
TotalSeq™-A 337111 TX25 CD226 (DNAM-1) Human 0805 AGACCAACTCATTCA
TotalSeq™-A 123913 OX-110 CD200R (OX2R) Mouse 0807 ATTCTTTCCCTCTGT
TotalSeq™-A 144523 J073E5 CD193 (CCR3) Mouse 0808 TAGAACCGTATCCGT
TotalSeq™-A 142209 Ba13 CD200R3 Mouse 0809 ATCAACTTGGAGCAG
TotalSeq™-A 142532 281-2 CD138 (Syndecan-1) Mouse 0810 GCGTTTGTATGTACT
TotalSeq™-A 127027 927 CD317 (BST2, PDCA-1) Mouse 0811 TGTGGTAGCCCTTGT
TotalSeq™-A 120421 MJ7/18 CD105 Mouse 0812 TATCCCTGCCTTGCA
TotalSeq™-A 124819 MZ3 CD9 Mouse 0813 TAGCAGTCACTCCTA
TotalSeq™-A 342211 HD30 CD205 (DEC-205) Human 0814 CTATCGTTTGATGCA
TotalSeq™-A 345123 ME20.4 CD271 (NGFR) Human 0816 AACCGCGCTTCAGAT
TotalSeq™-A 323307 W7C5 CD109 Human 0817 CACTTAACTCTGGGT
TotalSeq™-A 363425 m24 CD11a/CD18 (LFA-1) Human 0818 GCGATTCATGTCACG
TotalSeq™-A 352813 UV4 CD126 (IL-6Rα) Human 0819 TGATGGGAGCTTATC
TotalSeq™-A 324809 67D2 CD164 Human 0821 GAGGCACTTAACATA
TotalSeq™-A 365207 NY2 CD142 Human 0822 CACTGCCGTCGATTA
TotalSeq™-A 148711 1F11 P2X7R Mouse 0824 TGCTTCATTCATGTG
TotalSeq™-A 143407 5D3/CLEC12A CD371 (CLEC12A) Mouse 0825 GCGAGAAATCTGCAT
TotalSeq™-A 374411 H5/FcRL3 CD307c/FcRL3 Human 0826 GCCTAGTTTGAACGC
TotalSeq™-A 126113 OX-97 CD22 Mouse 0827 AGGTCCTCTCTGGAT
TotalSeq™-A 340209 413D12 CD307d (FcRL4) Human 0828 CGATTTGATCTGCCT
TotalSeq™-A 340307 509f6 CD307e (FcRL5) Human 0829 TCACGCAGTCCTCAA
TotalSeq™-A 331821 162.1 CD319 (CRACC) Human 0830 AGTATGCCATGTCTT
TotalSeq™-A 352325 DL-101 CD138 (Syndecan-1) Human 0831 GTATAGACCAAAGCC
TotalSeq™-A 143813 Duha59 CD39 Mouse 0834 GCGTATTTAACCCGT
TotalSeq™-A 130215 CX5 CD314 (NKG2D) Mouse 0835 GAGGCTTATCATTTC
TotalSeq™-A 144413 4C12 DR3 (TNFRSF25) Mouse 0836 GCTTGGGCAATTAAG
TotalSeq™-A 145317 DIH9 IL-33Rα (IL1RL1, ST2) Mouse 0837 GCGATGGAGCATGTT
TotalSeq™-A 144715 3D10 Ly49H Mouse 0839 CCAGTAGGCTTATTA
TotalSeq™-A 138309 4E5 Ly49D Mouse 0841 TATATCCCTCAACGC
TotalSeq™-A 116811 YE1/48.10.6 Ly-49A Mouse 0842 AATTCCGTCAGATGA
TotalSeq™-A 358919 L053E8 CD199 (CCR9) Human 0843 ATTCCTCATTCCTGA
TotalSeq™-A 310209 MEM-55 CD45RB Human 0844 AGATGGGACTCACCA
TotalSeq™-A 371317 3B2/TA8 CD99 Human 0845 ACCCGTCCCTAAGAA
TotalSeq™-A 145535 L138D7 CD185 (CXCR5) Mouse 0846 ACGTAGTCACCTAGT
TotalSeq™-A 117409 7E.17G9 CD278 (ICOS) Mouse 0847 ACTGCCATATCCCTA
TotalSeq™-A 142115 1G9 TIGIT (Vstm3) Mouse 0848 GAAAGTCGCCAACAG
TotalSeq™-A 104745 16-10A1 CD80 Mouse 0849 GACCCGGTGTCATTT
TotalSeq™-A 142613 HMα1 CD49a Mouse 0850 CCATTCATTTGTGGC
TotalSeq™-A 123529 1B1 CD1d (CD1.1, Ly-38) Mouse 0851 CAACTTGGCCGAATC
TotalSeq™-A 128823 10E5 CD226 (DNAM-1) Mouse 0852 ACGCAGTATTTCCGA
TotalSeq™-A 353613 50C1 CD371 (CLEC12A) Human 0853 CATTAGAGTCTGCCA
TotalSeq™-A 128619 HM34 CD34 Mouse 0857 GATTCCTTTACGAGC
TotalSeq™-A 352415 TRA-2-10 CD46 Human 0858 ACAGTACGACCTTCT
TotalSeq™-A 350409 50-6 CD151 (PETA-3) Human 0861 CTTACCTAGTCATTC
TotalSeq™-A 313815 H44 CD218a (IL-18Rα) Human 0862 TTGTTGTATCCGATC
TotalSeq™-A 366509 1D6 CD257 (BAFF, BLYS) Human 0863 CAGAGCACCCATTAA
TotalSeq™-A 372009 AYP1 CLEC1B (CLEC2) Human 0866 TGCCAGTATCACGTA
TotalSeq™-A 305521 DX22 CD94 Human 0867 CTTTCCGGTCCTACA
TotalSeq™-A 325517 MHE-18 IgE Human 0868 GGATGTACCGCGTAT
TotalSeq™-A 353907 1D12 CD365 (Tim-1) Human 0869 CTTCTGGGATTCTGG
TotalSeq™-A 306313 A12 (7D4) CD150 (SLAM) Human 0870 GTCATTGTATGTCTG
TotalSeq™-A 328821 KPL-1 CD162 Human 0871 ATATGTCAGAGCACC
TotalSeq™-A 326011 CD84.1.21 CD84 Human 0872 CTCCCTAGTTCCTTT
TotalSeq™-A 117614 MTS510 TLR4 (CD284)/MD2 Complex Mouse 0875 GCAGTTGTCCGATTC
TotalSeq™-A 148005 TX52 CD300c/d Mouse 0876 GTGATCTAAGATGCG
TotalSeq™-A 128507 4E10 JAML Mouse 0877 GTTATGGTTCGTGTT
TotalSeq™-A 139113 6A6 CD272 (BTLA) Mouse 0881 TGACCCTATTGAGAA
TotalSeq™-A 144105 6C1 PIR-A/B Mouse 0882 TGTAGAGTCAGACCT
TotalSeq™-A 137811 H194-112 CD26 (DPP-4) Mouse 0883 ATGGCCTGTCATAAT
TotalSeq™-A 128315 HMD1-3 DLL1 Mouse 0884 AGACCTCCTTACGAT
TotalSeq™-A 136307 HMHV-1B18 CD270 (HVEM) Mouse 0885 GATCCGTGTTGCCTA
TotalSeq™-A 130915 HMJ1-29 CD339 (Jagged 1) Mouse 0887 TAGTATGCTGGAGCG
TotalSeq™-A 107109 TKS-1 CD137L (4-1BB Ligand) Mouse 0890 CAGTTCAGTACGCAG
TotalSeq™-A 149209 YE1/19.1 ENPP1 Mouse 0891 CATTAACCGCCCTTA
TotalSeq™-A 100117 RM2-5 CD2 Mouse 0892 TTGCCGTGTGTTTAA
TotalSeq™-A 316531 MHK-49 Ig light chain κ Human 0894 AGCTCAGCCAGTATG
TotalSeq™-A 125421 M3/38 Mac-2 (Galectin-3) Mouse, Human 0895 GATGCAATTAGCCGG
TotalSeq™-A 333723 GHI/75 CD85j (ILT2) Human 0896 CCTTGTGAGGCTATG
TotalSeq™-A 338523 EBVCS-5 CD23 Human 0897 TCTGTATAACCGTCT
TotalSeq™-A 316627 MHL-38 Ig light chain λ Human 0898 CAGCCAGTAAGTCAC
TotalSeq™-A 343331 BB7.2 HLA-A2 Human 0899 GAACATTTCCGACAA
TotalSeq™-A 360607 L263G8 CD198 (CCR8) Human 0900 AGCCCGGATGTATTT
TotalSeq™-A 352515 7B11 GARP (LRRC32) Human 0901 AGGTATGGTAGAGTA
TotalSeq™-A 124633 3/23 CD40 Mouse 0903 ATTTGTATGCTGGAG
TotalSeq™-A 102437 390 CD31 Mouse 0904 GCTGTAGTATCATGT
TotalSeq™-A 121635 1D4B CD107a (LAMP-1) Mouse 0905 AAATCTGTGCCGTAC
TotalSeq™-A 408109 PE001 phycoerythrin (PE) N/A 0911 TGACCAGTTCCGCAT
TotalSeq™-A 144809 I015F8 CD124 (IL-4Rα) Mouse 0916 GAACCGTAGTATAAC
TotalSeq™-A 152614 SA367H8 CD95 (Fas) Mouse 0917 CACATCGTTTGTGTA
TotalSeq™-A 342617 3D12 HLA-E Human 0918 GAGTCGAGAAATCAT
TotalSeq™-A 317451 OKT4 CD4 Human 0922 GCGATCCCTTGAGAT
TotalSeq™-A 346709 5D12 NKp80 Human 0923 TATAGTTCCTCTGTG
TotalSeq™-A 322009 31G4D8 Lymphotoxin beta Receptor (LT-βR) Human 0932 CCTCTATTCAGAGCA
TotalSeq™-A 356305 M-B371 CD37 Human 0941 ACAGTCACTGGGCAA
TotalSeq™-A 405251   Biotin N/A 0951 AACCTTTGCCACTGC
TotalSeq™-A 405253   Biotin N/A 0952 GTCCGACTAATAGCT
TotalSeq™-A 405255   Biotin N/A 0953 CAGGTTGTTGTCATT
TotalSeq™-A 405257   Biotin N/A 0954 TATTTCCACCCGGTC
TotalSeq™-A 405259   Biotin N/A 0955 GTTGTGAGCACGAGA

No Results Found. Please try a different search term.


 

TotalSeq™-B

Download as Excel document:
Category Cat No. Clone Specificity Reactivity Barcode Sequence
TotalSeq™-B 100573 RM4-5 CD4 Mouse 0001 AACAAGACCCTTGAG
TotalSeq™-B 305241 2D10 CD80 Human 0005 ACGAATCAATCTGTG
TotalSeq™-B 305445 IT2.2 CD86 Human 0006 GTCTTTGTCAGTGCA
TotalSeq™-B 329749 29E.2A3 CD274 (B7-H1, PD-L1) Human 0007 GTTGTCCGACAATAC
TotalSeq™-B 105849 2B8 CD117 (c-Kit) Mouse 0012 TGCATGTCATCGGTG
TotalSeq™-B 337637 SKII.4 CD155 (PVR) Human 0023 ATCACATCGTTGCCA
TotalSeq™-B 336719 BJ40 CD48 Human 0029 CTACGACGTAGAAGA
TotalSeq™-B 334352 5C3 CD40 Human 0031 CTCAGATGGAGTATG
TotalSeq™-B 300477 UCHT1 CD3 Human 0034 CTCATTGTAACTCCT
TotalSeq™-B 344757 SK1 CD8 Human 0046 GCGCAACTTGATGAT
TotalSeq™-B 362561 5.1H11 CD56 (NCAM) Human 0047 TCCTTTCCTGATAGG
TotalSeq™-B 368547 2D1 CD45 Human 0048 TCCCTTGCGATTTAC
TotalSeq™-B 302263 HIB19 CD19 Human 0050 CTGGGCAATTACTCG
TotalSeq™-B 367145 63D3 CD14 Human 0051 CAATCAGACCTATGA
TotalSeq™-B 371523 S-HCL-3 CD11c Human 0053 TACGCCTATAACTTG
TotalSeq™-B 312235 HI10a CD10 Human 0062 CAGCCATTCATTAGG
TotalSeq™-B 304161 HI100 CD45RA Human 0063 TCAATCCTTCCGCTT
TotalSeq™-B 359427 L291H4 CD194 (CCR4) Human 0071 AGCTTACCTGCACGA
TotalSeq™-B 300565 RPA-T4 CD4 Human 0072 TGTTCCCGCTCAACT
TotalSeq™-B 301069 RPA-T8 CD8a Human 0080 GCTGCGCTTTCCATT
TotalSeq™-B 301857 M5E2 CD14 Human 0081 TCTCAGACCTCCGTA
TotalSeq™-B 302063 3G8 CD16 Human 0083 AAGTTCACTCTTTGC
TotalSeq™-B 392423 QA17A16 CD56 (NCAM) Human 0084 TTCGCCGCATTGAGT
TotalSeq™-B 302647 BC96 CD25 Human 0085 TTTGTCCTGTACGCC
TotalSeq™-B 304257 UCHL1 CD45RO Human 0087 CTCCGAATCATGTTG
TotalSeq™-B 329961 EH12.2H7 CD279 (PD-1) Human 0088 ACAGCGCCGTATTTA
TotalSeq™-B 372727 A15153G TIGIT (VSTM3) Human 0089 TTGCTTACCGCCAGA
TotalSeq™-B 400185 MOPC-21 N/A N/A 0090 GCCGGACGACATTAA
TotalSeq™-B 400291 MOPC-173 N/A N/A 0091 CTCCTACCTAAACTG
TotalSeq™-B 400379 MPC-11 N/A N/A 0092 ATATGTATCACGCGA
TotalSeq™-B 115563 6D5 CD19 Mouse 0093 ATCAGCCATGTCAGT
TotalSeq™-B 103161 30-F11 CD45 Mouse 0096 TGGCTATGGAGCAGA
TotalSeq™-B 302361 2H7 CD20 Human 0100 TTCTGGGTCCCTAGA
TotalSeq™-B 331939 9E2 CD335 (NKp46) Human 0101 ACAATTTGAACAGCG
TotalSeq™-B 117359 N418 CD11c Mouse 0106 GTTATGGACGCTTGC
TotalSeq™-B 101345 93 CD16/32 Mouse 0109 TTCGATGCTGGAGCA
TotalSeq™-B 108763 PK136 NK-1.1 Mouse 0118 GTAACATTACTCGTC
TotalSeq™-B 331233 B1 TCR γ/δ Human 0139 CTTCCGATTCATTCA
TotalSeq™-B 310949 FN50 CD69 Human 0146 GTCTCTTGGCTTAAA
TotalSeq™-B 304849 DREG-56 CD62L Human 0147 GTCCCTGCAACTTGA
TotalSeq™-B 353249 G043H7 CD197 (CCR7) Human 0148 AGTTCAGTCAACCGA
TotalSeq™-B 302851 O323 CD27 Human 0154 GCACTCCTGCATGTA
TotalSeq™-B 109859 104 CD45.2 Mouse 0157 CACCGTCATTCAACC
TotalSeq™-B 307661 L243 HLA-DR Human 0159 AATAGCGAGCAAGTA
TotalSeq™-B 301357 ICRF44 CD11b Human 0161 GACAAGTGATCTGCA
TotalSeq™-B 305049 10.1 CD64 Human 0162 AAGTATGCCCTACGA
TotalSeq™-B 320839 1D11 CD314 (NKG2D) Human 0165 CGTGTTTGTTCCTCA
TotalSeq™-B 393323 QA17A04 CD57 Human 0168 AACTCCCTATGGAGG
TotalSeq™-B 313551 C398.4A CD278 (ICOS) Human 0171 CGCGCACCCATTAAA
TotalSeq™-B 110755 A20 CD45.1 Mouse 0178 CCTATGGACTTGGAC
TotalSeq™-B 355707 K0124E1 CX3CR1 Human 0179 AGTATCGTCTCTGGG
TotalSeq™-B 311145 ML5 CD24 Human 0180 AGATTCCTTCGTGTT
TotalSeq™-B 100257 17A2 CD3 Mouse 0182 GTATGTCCGCTCGAT
TotalSeq™-B 321145 15-2 CD206 (MMR) Human 0205 TCAGAACGTCTAACT
TotalSeq™-B 372615 S15046E XCR1 Human 0208 AAGACGCATGTCAAC
TotalSeq™-B 306747 IP26 TCR α/β Human 0224 CGTAACGTAGAGCGA
TotalSeq™-B 309837 4B4-1 CD137 Human 0355 CAGTAAGTTCGGGAC
TotalSeq™-B 333639 GHI/61 CD163 Human 0358 GCTTCTCCTTCCTTA
TotalSeq™-B 301731 WM15 CD13 Human 0364 TTTCAACGCCCTTTC
TotalSeq™-B 303033 TS2/16 CD29 Human 0369 GTATTCCCTCAGTCA
TotalSeq™-B 354243 201A CD303 (BDCA-2) Human 0370 GAGATGTCCGAATTT
TotalSeq™-B 302961 CD28.2 CD28 Human 0386 TGAGAACGACCCTAA
TotalSeq™-B 351354 A019D5 CD127 (IL-7Rα) Human 0390 GTGTGTTGTCCTATG
TotalSeq™-B 304066 HI30 CD45 Human 0391 TGCAATTACCCGGAT
TotalSeq™-B 323051 W6D3 CD15 (SSEA-1) Human 0392 TCACCAGTACCTAGT
TotalSeq™-B 354529 12C2 CD304 (Neuropilin-1) Human 0406 GGACTAAGTTTCGTT
TotalSeq™-B 356639 HB-7 CD38 Human 0410 CCTATTCCGATTCCG
TotalSeq™-B 344033 AD2 CD73 (Ecto-5"-nucleotidase) Human 0577 CAGTTCCTCAGTTCG
TotalSeq™-B 351737 3C10 TCR V α7.2 Human 0581 TACGAGCAGTATTCA
TotalSeq™-B 331437 B6 TCR Vδ2 Human 0582 TCAGTCAGATGGTAT
TotalSeq™-B 331325 B3 TCR Vγ9 Human 0583 AAGTGATGGTATCTG
TotalSeq™-B 342933 6B11 TCR Vα24-Jα18 (iNKT cell) Human 0584 AACTTCTGTGGTAGC
TotalSeq™-B 312621 DX27 CD158b (KIR2DL2/L3, NKAT2) Human 0592 GACCCGTAGTTTGAT
TotalSeq™-B 142117 1G9 TIGIT (Vstm3) Mouse 0848 GAAAGTCGCCAACAG
TotalSeq™-B 125425 M3/38 Mac-2 (Galectin-3) Mouse, Human 0895 GATGCAATTAGCCGG

No Results Found. Please try a different search term.

TotalSeq™-C

Download as Excel document:
Category Cat No. Clone Specificity Reactivity Barcode Sequence
TotalSeq™-C 100571 RM4-5 CD4 Mouse 0001 AACAAGACCCTTGAG
TotalSeq™-C 305243 2D10 CD80 Human 0005 ACGAATCAATCTGTG
TotalSeq™-C 305447 IT2.2 CD86 Human 0006 GTCTTTGTCAGTGCA
TotalSeq™-C 329751 29E.2A3 CD274 (B7-H1, PD-L1) Human 0007 GTTGTCCGACAATAC
TotalSeq™-C 329621 24F.10C12 CD273 (B7-DC, PD-L2) Human 0008 TCAACGCTTGGCTAG
TotalSeq™-C 309419 2D3 CD275 (B7-H2, ICOSL) Human 0009 GTGCATTCAACAGTA
TotalSeq™-C 127657 1A8 Ly-6G Mouse 0015 ACATTGACGCAACTA
TotalSeq™-C 318815 122 CD270 (HVEM, TR2) Human 0020 TGATAGAAACAGACC
TotalSeq™-C 337635 SKII.4 CD155 (PVR) Human 0023 ATCACATCGTTGCCA
TotalSeq™-C 337419 TX31 CD112 (Nectin-2) Human 0024 AACCTTCCGTCTAAG
TotalSeq™-C 323131 CC2C6 CD47 Human 0026 GCATTCTGTCACCTA
TotalSeq™-C 355119 113-16 CD70 Human 0027 CGCGAACATAAGAAG
TotalSeq™-C 333919 BY88 CD30 Human 0028 TCAGGGTGTGCTGTA
TotalSeq™-C 336711 BJ40 CD48 Human 0029 CTACGACGTAGAAGA
TotalSeq™-C 334348 5C3 CD40 Human 0031 CTCAGATGGAGTATG
TotalSeq™-C 310849 24-31 CD154 Human 0032 GCTAGATAGATGCAA
TotalSeq™-C 316021 HI186 CD52 Human 0033 CTTTGTACGAGCAAA
TotalSeq™-C 300479 UCHT1 CD3 Human 0034 CTCATTGTAACTCCT
TotalSeq™-C 344651 SK3 CD4 Human 0045 GAGGTTAGTGATGGA
TotalSeq™-C 344753 SK1 CD8 Human 0046 GCGCAACTTGATGAT
TotalSeq™-C 362559 5.1H11 CD56 (NCAM) Human 0047 TCCTTTCCTGATAGG
TotalSeq™-C 368545 2D1 CD45 Human 0048 TCCCTTGCGATTTAC
TotalSeq™-C 344849 SK7 CD3 Human 0049 TATCCCTTGGGATGG
TotalSeq™-C 302265 HIB19 CD19 Human 0050 CTGGGCAATTACTCG
TotalSeq™-C 367137 63D3 CD14 Human 0051 CAATCAGACCTATGA
TotalSeq™-C 366633 P67.6 CD33 Human 0052 TAACTCAGGGCCTAT
TotalSeq™-C 371521 S-HCL-3 CD11c Human 0053 TACGCCTATAACTTG
TotalSeq™-C 356539 MI15 CD138 (Syndecan-1) Human 0055 ACTCTTTCGTTTACG
TotalSeq™-C 357523 19F2 CD269 (BCMA) Human 0056 CAGATGATCCACCAT
TotalSeq™-C 316323 2M2 β2-microglobulin Human 0057 CAGCCCGATTAAGGT
TotalSeq™-C 311449 W6/32 HLA-A,B,C Human 0058 TATGCGAGGCTTATC
TotalSeq™-C 328145 5E10 CD90 (Thy1) Human 0060 GCATTGTACGATTCA
TotalSeq™-C 313243 104D2 CD117 (c-kit) Human 0061 AGACTAATAGCTGAC
TotalSeq™-C 312233 HI10a CD10 Human 0062 CAGCCATTCATTAGG
TotalSeq™-C 304163 HI100 CD45RA Human 0063 TCAATCCTTCCGCTT
TotalSeq™-C 306045 6H6 CD123 Human 0064 CTTCACTCTGTCAGG
TotalSeq™-C 343127 CD7-6B7 CD7 Human 0066 TGGATTCCCGGACTT
TotalSeq™-C 313635 GoH3 CD49f Human, Mouse 0070 TTCCGAGGATGATCT
TotalSeq™-C 359425 L291H4 CD194 (CCR4) Human 0071 AGCTTACCTGCACGA
TotalSeq™-C 300567 RPA-T4 CD4 Human 0072 TGTTCCCGCTCAACT
TotalSeq™-C 103063 IM7 CD44 Mouse, Human 0073 TGGCTTCAGGTCCTA
TotalSeq™-C 301071 RPA-T8 CD8a Human 0080 GCTGCGCTTTCCATT
TotalSeq™-C 301859 M5E2 CD14 Human 0081 TCTCAGACCTCCGTA
TotalSeq™-C 302065 3G8 CD16 Human 0083 AAGTTCACTCTTTGC
TotalSeq™-C 392425 QA17A16 CD56 (NCAM) Human 0084 TTCGCCGCATTGAGT
TotalSeq™-C 302649 BC96 CD25 Human 0085 TTTGTCCTGTACGCC
TotalSeq™-C 304259 UCHL1 CD45RO Human 0087 CTCCGAATCATGTTG
TotalSeq™-C 329963 EH12.2H7 CD279 (PD-1) Human 0088 ACAGCGCCGTATTTA
TotalSeq™-C 372729 A15153G TIGIT (VSTM3) Human 0089 TTGCTTACCGCCAGA
TotalSeq™-C 400187 MOPC-21 N/A N/A 0090 GCCGGACGACATTAA
TotalSeq™-C 400293 MOPC-173 N/A N/A 0091 CTCCTACCTAAACTG
TotalSeq™-C 400381 MPC-11 N/A N/A 0092 ATATGTATCACGCGA
TotalSeq™-C 400677 RTK4530 N/A N/A 0095 GATTCTTGACGACCT
TotalSeq™-C 302363 2H7 CD20 Human 0100 TTCTGGGTCCCTAGA
TotalSeq™-C 331941 9E2 CD335 (NKp46) Human 0101 ACAATTTGAACAGCG
TotalSeq™-C 350131 BM16 CD294 (CRTH2) Human 0102 TGTTTACGAGAGCCC
TotalSeq™-C 117361 N418 CD11c Mouse 0106 GTTATGGACGCTTGC
TotalSeq™-C 118141 GL3 TCR γ/δ Mouse 0121 AACCCAAATAGCTGA
TotalSeq™-C 324247 9C4 CD326 (EpCAM) Human 0123 TTCCGAGCAAGTATC
TotalSeq™-C 303139 WM59 CD31 Human 0124 ACCTTTATGCCACGG
TotalSeq™-C 338827 BJ18 CD44 Human 0125 AATCCTTCCGAATGT
TotalSeq™-C 337031 NC-08 Podoplanin Human 0127 GGTTACTCGTTGTGT
TotalSeq™-C 361033 P1H12 CD146 Human 0134 CCTTGGATAACATCA
TotalSeq™-C 314547 MHM-88 IgM Human 0136 TAGCGAGCCCGTATA
TotalSeq™-C 300637 UCHT2 CD5 Human 0138 CATTAACGGGATGCC
TotalSeq™-C 331231 B1 TCR γ/δ Human 0139 CTTCCGATTCATTCA
TotalSeq™-C 353747 G025H7 CD183 (CXCR3) Human 0140 GCGATGGTAGATTAT
TotalSeq™-C 359137 J418F1 CD195 (CCR5) Human 0141 CCAAAGTAAGAGCCA
TotalSeq™-C 303225 FUN-2 CD32 Human 0142 GCTTCCGAATTACCG
TotalSeq™-C 353440 G034E3 CD196 (CCR6) Human 0143 GATCCCTTTGTCACT
TotalSeq™-C 356939 J252D4 CD185 (CXCR5) Human 0144 AATTCAACCGTCGCC
TotalSeq™-C 350233 Ber-ACT8 CD103 Human 0145 GACCTCATTGTGAAT
TotalSeq™-C 310951 FN50 CD69 Human 0146 GTCTCTTGGCTTAAA
TotalSeq™-C 304851 DREG-56 CD62L Human 0147 GTCCCTGCAACTTGA
TotalSeq™-C 353251 G043H7 CD197 (CCR7) Human 0148 AGTTCAGTCAACCGA
TotalSeq™-C 339947 HP-3G10 CD161 Human 0149 GTACGCAGTCCTTCT
TotalSeq™-C 369621 BNI3 CD152 Human 0151 ATGGTTCACGTAATC
TotalSeq™-C 369335 11C3C65 CD223 (LAG-3) Human 0152 CATTTGTCTGCCGGT
TotalSeq™-C 302853 O323 CD27 Human 0154 GCACTCCTGCATGTA
TotalSeq™-C 328649 H4A3 CD107a (LAMP-1) Human 0155 CAGCCCACTGCAATA
TotalSeq™-C 305651 DX2 CD95 (Fas) Human 0156 CCAGCTCATTAGAGC
TotalSeq™-C 109855 104 CD45.2 Mouse 0157 CACCGTCATTCAACC
TotalSeq™-C 350035 Ber-ACT35 (ACT35) CD134 (OX40) Human 0158 AACCCACCGTTGTTA
TotalSeq™-C 307663 L243 HLA-DR Human 0159 AATAGCGAGCAAGTA
TotalSeq™-C 331547 L161 CD1c Human 0160 GAGCTACTTCACTCG
TotalSeq™-C 301359 ICRF44 CD11b Human 0161 GACAAGTGATCTGCA
TotalSeq™-C 305045 10.1 CD64 Human 0162 AAGTATGCCCTACGA
TotalSeq™-C 344125 M80 CD141 (Thrombomodulin) Human 0163 GGATAACCGCGCTTT
TotalSeq™-C 350319 51.1 CD1d Human 0164 TCGAGTCGCTTATCA
TotalSeq™-C 320837 1D11 CD314 (NKG2D) Human 0165 CGTGTTTGTTCCTCA
TotalSeq™-C 392909 6/40c CD66b Human 0166 AGCTGTAAGTTTCGG
TotalSeq™-C 333409 E11 CD35 Human 0167 ACTTCCGTCGATCTT
TotalSeq™-C 393321 QA17A04 CD57 Human 0168 AACTCCCTATGGAGG
TotalSeq™-C 345049 F38-2E2 CD366 (Tim-3) Human 0169 TGTCCTACCCAACTT
TotalSeq™-C 344527 MIH26 CD272 Human 0170 GTTATTGGACTAAGG
TotalSeq™-C 313553 C398.4A CD278 (ICOS) Human 0171 CGCGCACCCATTAAA
TotalSeq™-C 330921 TS2/9 CD58 Human 0174 GTTCCTATGGACGAC
TotalSeq™-C 338423 NK92.39 CD96 (TACTILE) Human 0175 TGGCCTATAAATGGT
TotalSeq™-C 328237 A1 CD39 Human 0176 TTACCTGGTATCCGT
TotalSeq™-C 110757 A20 CD45.1 Mouse 0178 CCTATGGACTTGGAC
TotalSeq™-C 355705 K0124E1 CX3CR1 Human 0179 AGTATCGTCTCTGGG
TotalSeq™-C 311143 ML5 CD24 Human 0180 AGATTCCTTCGTGTT
TotalSeq™-C 354923 Bu32 CD21 Human 0181 AACCTAGTAGTTCGG
TotalSeq™-C 350617 TS2/4 CD11a Human 0185 TATATCCTTGTGAGC
TotalSeq™-C 341417 CB3-1 CD79b (Igβ) Human 0187 ATTCTTCAACCGAAG
TotalSeq™-C 342325 ASL-32 CD66a/c/e Human 0188 GGGACAGTTCGTTTC
TotalSeq™-C 329529 C1.7 CD244 (2B4) Human 0189 TCGCTTGGATGGTAG
TotalSeq™-C 306625 HIR2 CD235ab Human 0196 GCTCCTTTACACGTA
TotalSeq™-C 321147 15-2 CD206 (MMR) Human 0205 TCAGAACGTCTAACT
TotalSeq™-C 346021 7-239 CD169 (Sialoadhesin, Siglec-1) Human 0206 TACTCAGCGTGTTTG
TotalSeq™-C 372617 S15046E XCR1 Human 0208 AAGACGCATGTCAAC
TotalSeq™-C 137713 UC3-10A6 TCR Vγ2 Mouse 0211 AAGCTGCACCGTAAT
TotalSeq™-C 101843 M1/69 CD24 Mouse 0212 TATATCTTTGCCGCA
TotalSeq™-C 321229 FIB504 Integrin β7 Human 0214 TCCTTGGATGTACCG
TotalSeq™-C 316927 11C1 CD268 (BAFF-R) Human 0215 CGAAGTCGATCCGTA
TotalSeq™-C 353127 HA58 CD54 Human 0217 CTGATAGACTTGAGT
TotalSeq™-C 306743 IP26 TCR α/β Human 0224 CGTAACGTAGAGCGA
TotalSeq™-C 339021 TU27 CD122 (IL-2Rβ) Human 0246 TCATTTCCTCCGATT
TotalSeq™-C 138433 2F1/KLRG1 KLRG1 (MAFA) Mouse, Human 0250 GTAGTAGGCTAGACC
TotalSeq™-C 334645 AER-37 (CRA-1) FcεRIα Human 0352 CTCGTTTCCGTATCG
TotalSeq™-C 303739 HIP8 CD41 Human 0353 ACGTTGTGGCCTTGT
TotalSeq™-C 139519 MR9-4 TCR Vβ5.1, 5.2 Mouse 0354 CTCAACAGTATTCTG
TotalSeq™-C 309839 4B4-1 CD137 Human 0355 CAGTAAGTTCGGGAC
TotalSeq™-C 347511 MIH24 CD254 (TRANCE, RANKL) Human 0356 TCCGTGTTAGTTTGT
TotalSeq™-C 333637 GHI/61 CD163 Human 0358 GCTTCTCCTTCCTTA
TotalSeq™-C 305341 HB15e CD83 Human 0359 CCACTCATTTCCGGT
TotalSeq™-C 371227 108-17 CD357 (GITR) Human 0360 ACCTTTCGACACTCG
TotalSeq™-C 355011 G077F6 CD124 (IL-4Rα) Human 0363 CCGTCCTGATAGATG
TotalSeq™-C 306533 12G5 CD184 (CXCR4) Human 0366 TCAGGTCCTTTCAAC
TotalSeq™-C 309231 TS1/8 CD2 Human 0367 TACGATTTGTCAGGG
TotalSeq™-C 338337 11A8 CD226 (DNAM-1) Human 0368 TCTCAGTGTTTGTGG
TotalSeq™-C 303029 TS2/16 CD29 Human 0369 GTATTCCCTCAGTCA
TotalSeq™-C 354241 201A CD303 (BDCA-2) Human 0370 GAGATGTCCGAATTT
TotalSeq™-C 349523 5A6 CD81 (TAPA-1) Human 0373 GTATCCTTCCTTGGC
TotalSeq™-C 315607 MEM-108 CD98 Human 0374 GCACCAACAGCCATT
TotalSeq™-C 410727 M1310G05 IgG Fc Human 0375 CTGGAGCGATTAGAA
TotalSeq™-C 120131 4B12 CD197 (CCR7) Mouse 0377 TTATTAACAGCCCAC
TotalSeq™-C 348245 IA6-2 IgD Human 0384 CAGTCTCCGTAGAGT
TotalSeq™-C 302129 TS1/18 CD18 Human 0385 TATTGGGACACTTCT
TotalSeq™-C 302963 CD28.2 CD28 Human 0386 TGAGAACGACCCTAA
TotalSeq™-C 322909 1D3 TSLPR (TSLP-R) Human 0387 CAGTCCTCTCTGTCA
TotalSeq™-C 303543 HIT2 CD38 Human 0389 TGTACCCGCTTGTGA
TotalSeq™-C 351356 A019D5 CD127 (IL-7Rα) Human 0390 GTGTGTTGTCCTATG
TotalSeq™-C 304068 HI30 CD45 Human 0391 TGCAATTACCCGGAT
TotalSeq™-C 323053 W6D3 CD15 (SSEA-1) Human 0392 TCACCAGTACCTAGT
TotalSeq™-C 363516 S-HCL-1 CD22 Human 0393 GGGTTGTTGTCTTTG
TotalSeq™-C 334125 CY1G4 CD71 Human 0394 CCGTGTTCCTCATTA
TotalSeq™-C 358116 MIH43 B7-H4 Human 0395 TGTATGTCTGCCTTG
TotalSeq™-C 302722 BA5b CD26 Human 0396 GGTGGCTAGATAATG
TotalSeq™-C 300135 HI149 CD1a Human 0402 GATCGTGTTGTGTTA
TotalSeq™-C 354527 12C2 CD304 (Neuropilin-1) Human 0406 GGACTAAGTTTCGTT
TotalSeq™-C 336227 5-271 CD36 Human 0407 TTCTTTGCCTTGCCA
TotalSeq™-C 339517 HP-MA4 CD158 Human 0420 TATCAACCAACGCTT
TotalSeq™-C 149043 SA011F11 CX3CR1 Mouse 0563 CACTCTCAGTCCTAT
TotalSeq™-C 148229 ZET XCR1 Mouse 0568 TCCATTACCCACGTT
TotalSeq™-C 304345 9F10 CD49d Human 0576 CCATTCAACTTCCGG
TotalSeq™-C 344031 AD2 CD73 (Ecto-5"-nucleotidase) Human 0577 CAGTTCCTCAGTTCG
TotalSeq™-C 351735 3C10 TCR Vα7.2 Human 0581 TACGAGCAGTATTCA
TotalSeq™-C 331435 B6 TCR Vδ2 Human 0582 TCAGTCAGATGGTAT
TotalSeq™-C 331313 B3 TCR Vγ9 Human 0583 AAGTGATGGTATCTG
TotalSeq™-C 342925 6B11 TCR Vα24-Jα18 (iNKT cell) Human 0584 AACTTCTGTGGTAGC
TotalSeq™-C 394007 S16016B CD133 Human 0594 GTAAGACGCCTATGC
TotalSeq™-C 312725 DX9 CD158e1 (KIR3DL1, NKB1) Human 0599 GGACGCTTTCCTTGA
TotalSeq™-C 341309 UP-R1 CD158f (KIR2DL5) Human 0600 AAAGTGATGCCACTG
TotalSeq™-C 325219 P30-15 CD337 (NKp30) Human 0801 AAAGTCACTCTGCCG
TotalSeq™-C 325119 P44-8 CD336 (NKp44) Human 0802 GGGCAATTAGCGAGT
TotalSeq™-C 127035 927 CD317 (BST2, PDCA-1) Mouse 0811 TGTGGTAGCCCTTGT
TotalSeq™-C 331823 162.1 CD319 (CRACC) Human 0830 AGTATGCCATGTCTT
TotalSeq™-C 352327 DL-101 CD138 (Syndecan-1) Human 0831 GTATAGACCAAAGCC
TotalSeq™-C 143815 Duha59 CD39 Mouse 0834 GCGTATTTAACCCGT
TotalSeq™-C 145537 L138D7 CD185 (CXCR5) Mouse 0846 ACGTAGTCACCTAGT
TotalSeq™-C 117411 7E.17G9 CD278 (ICOS) Mouse 0847 ACTGCCATATCCCTA
TotalSeq™-C 104755 16-10A1 CD80 Mouse 0849 GACCCGGTGTCATTT
TotalSeq™-C 353615 50C1 CD371 (CLEC12A) Human 0853 CATTAGAGTCTGCCA
TotalSeq™-C 305523 DX22 CD94 Human 0867 CTTTCCGGTCCTACA
TotalSeq™-C 316533 MHK-49 Ig light chain κ Human 0894 AGCTCAGCCAGTATG
TotalSeq™-C 125423 M3/38 Mac-2 (Galectin-3) Mouse, Human 0895 GATGCAATTAGCCGG
TotalSeq™-C 333725 GHI/75 CD85j Human 0896 CCTTGTGAGGCTATG
TotalSeq™-C 338525 EBVCS-5 CD23 Human 0897 TCTGTATAACCGTCT
TotalSeq™-C 316629 MHL-38 Ig light chain λ Human 0898 CAGCCAGTAAGTCAC
TotalSeq™-C 339213 6-434 CD328 (Siglec-7) Human 0902 CTTAGCATTTCACTG
TotalSeq™-C 124635 3/23 CD40 Mouse 0903 ATTTGTATGCTGGAG
TotalSeq™-C 102441 390 CD31 Mouse 0904 GCTGTAGTATCATGT
TotalSeq™-C 121637 1D4B CD107a (LAMP-1) Mouse 0905 AAATCTGTGCCGTAC
TotalSeq™-C 150321 SA214G2 CD198 (CCR8) Mouse 0907 ATCTCCGTTGTGCGA
TotalSeq™-C 149319 SA044G4 CD182 Mouse 0909 TTTCCTTGTAGAGCG
TotalSeq™-C 104323 2C9.G2 (HMβ3-1) CD61 Mouse 0910 TTCTTTACCCGCCTG
TotalSeq™-C 408111 PE001 phycoerythrin (PE) N/A 0911 TGACCAGTTCCGCAT
TotalSeq™-C 342115 ASL-24 CD82 Human 0920 TCCCACTTCCGCTTT
TotalSeq™-C 405261   Biotin N/A 0951 AACCTTTGCCACTGC
TotalSeq™-C 405263   Biotin N/A 0952 GTCCGACTAATAGCT
TotalSeq™-C 405265   Biotin N/A 0953 CAGGTTGTTGTCATT
TotalSeq™-C 405267   Biotin N/A 0954 TATTTCCACCCGGTC
TotalSeq™-C 405269   Biotin N/A 0955 GTTGTGAGCACGAGA
TotalSeq™-C 405271   Biotin N/A 0971 ATGCGATCAGACCGA
TotalSeq™-C 405273   Biotin N/A 0972 CGTATGCGCTTCAAG
TotalSeq™-C 127829 B20.1 TCR Vα2 Mouse 0981 TTGACCCGCTACGAA
TotalSeq™-C 127709 B21.14 TCR Vα8.3 Mouse 0982 TTAGAGTCGCTTGGA
TotalSeq™-C 125711 KT50 TCR Vα8.3 Mouse 0983 CTTTCCCTAGTATGC
TotalSeq™-C 139905 RR8-1 TCR Vα11.1, 11.2 Mouse 0984 CTTACCCGGATTCTA

No Results Found. Please try a different search term.

Conjugation of antibodies to oligonucleotides has many applications, from their potential utility as adjuvants or targeted drug delivery systems, to the recently published simultaneous protein and RNA quantification in single cells, these reagents are opening new avenues to enable researchers move forward the frontiers of science.


A recent publication by Stoeckius et al. used antibodies coupled with oligonucleotides to simultaneously measure proteins and RNA at a single cell level. The method, termed cellular indexing of transcriptomes and epitopes by sequencing (CITE-seq), combines highly multiplexed protein marker detection with unbiased transcriptome profiling for thousands of single cells. The authors also report that the method is compatible with two high-throughput scRNA-seq platforms, Drop-seq and 10X Genomics. A similar approach was used by Peterson et al., they termed their workflow RNA expression and protein sequencing assay (REAP-seq).

Originally, Stoeckius et al. used antibodies conjugated to streptavidin and biotinylated oligonucleotides to link the antibody and the oligonucleotide together. BioLegend is now offering antibodies directly conjugated to oligonucleotides, under our brand name TotalSeq™, to help accelerate single cell genomics and other applications.


BioLegend’s revolutionary TotalSeq™ product suite integrates seamlessly with these workflows, and enables highly multiplexed proteomics and proteogenomics across a range of next generation sequencing applications, from bulk sample analysis to highly parallel single cell sequencing. Read the press releases announcing BioLegend and New York Genome Center® exclusive global license and research agreement, as well as our collaboration with 10x Genomics. To view the list of already assigned barcodes, please click in the Barcodes tab. To request a custom conjugated antibody, please fill in the Custom Order Form.

 

  1. Stain with TotalSeq™ reagents
  2. Run single cell platform, with Antibody- Derived Tags (ADT, antibody-oligo conjugates) amplification
  3. Separate ADT-derived cDNA from mRNA-derived cDNA
  4. Amplify both cDNA libraries
  5. Sequence libraries

 

Fig 1. Diagram illustrating CITE-seq workflow. Step 2 can be performed by Drop-seq (depicted in the figure), or another compatible method such as 10X Genomics platform.

 

 

Fig 2. Clustering of approximately 5,000 CITE-seq single-cell expression profiles of PBMCs reveals distinct cell populations based on transcriptome analysis. The left panel shows a two-dimensional representation (tSNE) of global gene expression relationships among all cells. Major cell types in peripheral blood can be discerned based on marker gene expression as indicated. The right panels show mRNA (blue) and corresponding Antibody-Derived Tag (ADT, green) signal for the CITE-seq antibody panel projected on the tSNE plot. Darker shading corresponds to higher levels measured.

In addition to our collection of antibody oligonucleotide conjugates for protein quantification, we are also refining the process of identifying each cell with its sample origin, as well as data generated from doublets instead of single cells when mixing multiple samples. The method is powered by our cell hashtag reagents. Please read Stoeckius M. et al. for more information about cell hashing.

 

The hashtags are designed so that they are specific for human or mouse cells, and to cover as many cells as possible. For human samples the hashtags are made of two antibodies that recognize ubiquitous surface markers, CD298 and β2 microglobulin, each conjugated to the same oligonucleotide containing the barcode sequence. For mouse samples, the surface markers are CD45 and H-2 MHC class I. The conjugates are already pre-mixed and ready to use.

 

For TotalSeq™-A reagents, the PCR handle between regular antibodies and the hashtag versions is different. In practice, this means that two different libraries can be prepared, one for the regular antibodies (commonly referred as ADT), and one for the hashtags (commonly referred to as HTO). They can then be mixed at different ratios before sequencing, to avoid an excess of HTO readings.

 

For TotalSeq™-C reagents, the PCR handle and capture sequence between regular antibodies and the hashtag versions is the same. In practice, this means that preparation of two different libraries is no longer possible. Thus, the most efficient way to avoid an excess of HTO readings is to titrate the Hashtag reagents. There are several ways to titrate TotalSeq™ reagents. Please read the FAQs for more information.

The tables below contains barcodes for products available to purchase, as well as conjugates that will released in the future.

 

Click on the links below to jump to a table.

TotalSeq™-A

TotalSeq™-B

TotalSeq™-C

TotalSeq™-A

Download as Excel document:
Category Cat No. Clone Description Specificity Reactivity Barcode Sequence
TotalSeq™-A 394601 LNH-94; 2M2 0251 anti-human Hashtag 1 CD298 and β2 microglobulin Human 0251 GTCAACTCTTTAGCG
TotalSeq™-A 394603 LNH-94; 2M2 0252 anti-human Hashtag 2 CD298 and β2 microglobulin Human 0252 TGATGGCCTATTGGG
TotalSeq™-A 394605 LNH-94; 2M2 0253 anti-human Hashtag 3 CD298 and β2 microglobulin Human 0253 TTCCGCCTCTCTTTG
TotalSeq™-A 394607 LNH-94; 2M2 0254 anti-human Hashtag 4 CD298 and β2 microglobulin Human 0254 AGTAAGTTCAGCGTA
TotalSeq™-A 394609 LNH-94; 2M2 0255 anti-human Hashtag 5 CD298 and β2 microglobulin Human 0255 AAGTATCGTTTCGCA
TotalSeq™-A 394611 LNH-94; 2M2 0256 anti-human Hashtag 6 CD298 and β2 microglobulin Human 0256 GGTTGCCAGATGTCA
TotalSeq™-A 394613 LNH-94; 2M2 0257 anti-human Hashtag 7 CD298 and β2 microglobulin Human 0257 TGTCTTTCCTGCCAG
TotalSeq™-A 394615 LNH-94; 2M2 0258 anti-human Hashtag 8 CD298 and β2 microglobulin Human 0258 CTCCTCTGCAATTAC
TotalSeq™-A 394617 LNH-94; 2M2 0259 anti-human Hashtag 9 CD298 and β2 microglobulin Human 0259 CAGTAGTCACGGTCA
TotalSeq™-A 394619 LNH-94; 2M2 0260 anti-human Hashtag 10 CD298 and β2 microglobulin Human 0260 ATTGACCCGCGTTAG
TotalSeq™-A 394623 LNH-94; 2M2 0262 anti-human Hashtag 12 CD298 and β2 microglobulin Human 0262 TAACGACCAGCCATA
TotalSeq™-A 394625 LNH-94; 2M2 0263 anti-human Hashtag 13 CD298 and β2 microglobulin Human 0263 AAATCTCTCAGGCTC
TotalSeq™-A 394627 LNH-94; 2M2 0264 anti-human Hashtag 14 CD298 and β2 microglobulin Human 0264 CTGTATGTCCGATTG
TotalSeq™-A 394629 LNH-94; 2M2 0265 anti-human Hashtag 15 CD298 and β2 microglobulin Human 0265 TAAGATTCAGAGCGA
TotalSeq™-A 155801 M1/42; 30-F11 0301 anti-mouse Hashtag 1  CD45 and MHC class I Mouse 0301 ACCCACCAGTAAGAC
TotalSeq™-A 155803 M1/42; 30-F11 0302 anti-mouse Hashtag 2  CD45 and MHC class I Mouse 0302 GGTCGAGAGCATTCA
TotalSeq™-A 155805 M1/42; 30-F11 0303 anti-mouse Hashtag 3  CD45 and MHC class I Mouse 0303 CTTGCCGCATGTCAT
TotalSeq™-A 155807 M1/42; 30-F11 0304 anti-mouse Hashtag 4  CD45 and MHC class I Mouse 0304 AAAGCATTCTTCACG
TotalSeq™-A 155809 M1/42; 30-F11 0305 anti-mouse Hashtag 5  CD45 and MHC class I Mouse 0305 CTTTGTCTTTGTGAG
TotalSeq™-A 155811 M1/42; 30-F11 0306 anti-mouse Hashtag 6  CD45 and MHC class I Mouse 0306 TATGCTGCCACGGTA
TotalSeq™-A 155813 M1/42; 30-F11 0307 anti-mouse Hashtag 7  CD45 and MHC class I Mouse 0307 GAGTCTGCCAGTATC
TotalSeq™-A 155815 M1/42; 30-F11 0308 anti-mouse Hashtag 8  CD45 and MHC class I Mouse 0308 TATAGAACGCCAGGC
TotalSeq™-A 155817 M1/42; 30-F11 0309 anti-mouse Hashtag 9  CD45 and MHC class I Mouse 0309 TGCCTATGAAACAAG
TotalSeq™-A 155819 M1/42; 30-F11 0310 anti-mouse Hashtag 10  CD45 and MHC class I Mouse 0310 CCGATTGTAACAGAC
TotalSeq™-A 155821 M1/42; 30-F11 0311 anti-mouse Hashtag 11  CD45 and MHC class I Mouse 0311 GCTTACCGAATTAAC
TotalSeq™-A 155823 M1/42; 30-F11 0312 anti-mouse Hashtag 12  CD45 and MHC class I Mouse 0312 CTGCAAATATAACGG
TotalSeq™-A 155825 M1/42; 30-F11 0313 anti-mouse Hashtag 13  CD45 and MHC class I Mouse 0313 CTACATTGCGATTTG
TotalSeq™-A 155827 M1/42; 30-F11 0314 anti-mouse Hashtag 14  CD45 and MHC class I Mouse 0314 CTTTCGCCAACTCTG
TotalSeq™-A 155829 M1/42; 30-F11 0315 anti-mouse Hashtag 15  CD45 and MHC class I Mouse 0315 CCCTCTCTGGATTCT

No Results Found. Please try a different search term.

TotalSeq™-B

Download as Excel document:
Category Cat No. Clone Description Specificity Reactivity Barcode Sequence
TotalSeq™-B 394631 LNH-94; 2M2 0251 anti-human Hashtag 1 CD298 and β2 microglobulin Human 0251 GTCAACTCTTTAGCG
TotalSeq™-B 394633 LNH-94; 2M2 0252 anti-human Hashtag 2 CD298 and β2 microglobulin Human 0252 TGATGGCCTATTGGG
TotalSeq™-B 394635 LNH-94; 2M2 0253 anti-human Hashtag 3 CD298 and β2 microglobulin Human 0253 TTCCGCCTCTCTTTG
TotalSeq™-B 394637 LNH-94; 2M2 0254 anti-human Hashtag 4 CD298 and β2 microglobulin Human 0254 AGTAAGTTCAGCGTA
TotalSeq™-B 394639 LNH-94; 2M2 0255 anti-human Hashtag 5 CD298 and β2 microglobulin Human 0255 AAGTATCGTTTCGCA
TotalSeq™-B 394641 LNH-94; 2M2 0256 anti-human Hashtag 6 CD298 and β2 microglobulin Human 0256 GGTTGCCAGATGTCA
TotalSeq™-B 394643 LNH-94; 2M2 0257 anti-human Hashtag 7 CD298 and β2 microglobulin Human 0257 TGTCTTTCCTGCCAG
TotalSeq™-B 394645 LNH-94; 2M2 0258 anti-human Hashtag 8 CD298 and β2 microglobulin Human 0258 CTCCTCTGCAATTAC
TotalSeq™-B 394647 LNH-94; 2M2 0259 anti-human Hashtag 9 CD298 and β2 microglobulin Human 0259 CAGTAGTCACGGTCA
TotalSeq™-B 394649 LNH-94; 2M2 0260 anti-human Hashtag 10 CD298 and β2 microglobulin Human 0260 ATTGACCCGCGTTAG
TotalSeq™-B 155831 M1/42; 30-F11 0301 anti-mouse Hashtag 1  CD45 and MHC class I Mouse 0301 ACCCACCAGTAAGAC
TotalSeq™-B 155833 M1/42; 30-F11 0302 anti-mouse Hashtag 2  CD45 and MHC class I Mouse 0302 GGTCGAGAGCATTCA
TotalSeq™-B 155835 M1/42; 30-F11 0303 anti-mouse Hashtag 3  CD45 and MHC class I Mouse 0303 CTTGCCGCATGTCAT
TotalSeq™-B 155837 M1/42; 30-F11 0304 anti-mouse Hashtag 4  CD45 and MHC class I Mouse 0304 AAAGCATTCTTCACG
TotalSeq™-B 155839 M1/42; 30-F11 0305 anti-mouse Hashtag 5  CD45 and MHC class I Mouse 0305 CTTTGTCTTTGTGAG
TotalSeq™-B 155841 M1/42; 30-F11 0306 anti-mouse Hashtag 6  CD45 and MHC class I Mouse 0306 TATGCTGCCACGGTA
TotalSeq™-B 155843 M1/42; 30-F11 0307 anti-mouse Hashtag 7  CD45 and MHC class I Mouse 0307 GAGTCTGCCAGTATC
TotalSeq™-B 155845 M1/42; 30-F11 0308 anti-mouse Hashtag 8  CD45 and MHC class I Mouse 0308 TATAGAACGCCAGGC
TotalSeq™-B 155847 M1/42; 30-F11 0309 anti-mouse Hashtag 9  CD45 and MHC class I Mouse 0309 TGCCTATGAAACAAG
TotalSeq™-B 155849 M1/42; 30-F11 0310 anti-mouse Hashtag 10  CD45 and MHC class I Mouse 0310 CCGATTGTAACAGAC

No Results Found. Please try a different search term.

TotalSeq™-C

Download as Excel document:
Category Cat No. Clone Description Specificity Reactivity Barcode Sequence
TotalSeq™-C 394661 LNH-94; 2M2 0251 anti-human Hashtag 1 CD298 and β2 microglobulin Human 0251 GTCAACTCTTTAGCG
TotalSeq™-C 394663 LNH-94; 2M2 0252 anti-human Hashtag 2 CD298 and β2 microglobulin Human 0252 TGATGGCCTATTGGG
TotalSeq™-C 394665 LNH-94; 2M2 0253 anti-human Hashtag 3 CD298 and β2 microglobulin Human 0253 TTCCGCCTCTCTTTG
TotalSeq™-C 394667 LNH-94; 2M2 0254 anti-human Hashtag 4 CD298 and β2 microglobulin Human 0254 AGTAAGTTCAGCGTA
TotalSeq™-C 394669 LNH-94; 2M2 0255 anti-human Hashtag 5 CD298 and β2 microglobulin Human 0255 AAGTATCGTTTCGCA
TotalSeq™-C 394671 LNH-94; 2M2 0256 anti-human Hashtag 6 CD298 and β2 microglobulin Human 0256 GGTTGCCAGATGTCA
TotalSeq™-C 394673 LNH-94; 2M2 0257 anti-human Hashtag 7 CD298 and β2 microglobulin Human 0257 TGTCTTTCCTGCCAG
TotalSeq™-C 394675 LNH-94; 2M2 0258 anti-human Hashtag 8 CD298 and β2 microglobulin Human 0258 CTCCTCTGCAATTAC
TotalSeq™-C 394677 LNH-94; 2M2 0259 anti-human Hashtag 9 CD298 and β2 microglobulin Human 0259 CAGTAGTCACGGTCA
TotalSeq™-C 394679 LNH-94; 2M2 0260 anti-human Hashtag 10 CD298 and β2 microglobulin Human 0260 ATTGACCCGCGTTAG
TotalSeq™-C 155861 M1/42; 30-F11 0301 anti-mouse Hashtag 1  CD45 and MHC class I Mouse 0301 ACCCACCAGTAAGAC
TotalSeq™-C 155863 M1/42; 30-F11 0302 anti-mouse Hashtag 2  CD45 and MHC class I Mouse 0302 GGTCGAGAGCATTCA
TotalSeq™-C 155865 M1/42; 30-F11 0303 anti-mouse Hashtag 3  CD45 and MHC class I Mouse 0303 CTTGCCGCATGTCAT
TotalSeq™-C 155867 M1/42; 30-F11 0304 anti-mouse Hashtag 4  CD45 and MHC class I Mouse 0304 AAAGCATTCTTCACG
TotalSeq™-C 155869 M1/42; 30-F11 0305 anti-mouse Hashtag 5  CD45 and MHC class I Mouse 0305 CTTTGTCTTTGTGAG
TotalSeq™-C 155871 M1/42; 30-F11 0306 anti-mouse Hashtag 6  CD45 and MHC class I Mouse 0306 TATGCTGCCACGGTA
TotalSeq™-C 155873 M1/42; 30-F11 0307 anti-mouse Hashtag 7  CD45 and MHC class I Mouse 0307 GAGTCTGCCAGTATC
TotalSeq™-C 155875 M1/42; 30-F11 0308 anti-mouse Hashtag 8  CD45 and MHC class I Mouse 0308 TATAGAACGCCAGGC
TotalSeq™-C 155877 M1/42; 30-F11 0309 anti-mouse Hashtag 9  CD45 and MHC class I Mouse 0309 TGCCTATGAAACAAG
TotalSeq™-C 155879 M1/42; 30-F11 0310 anti-mouse Hashtag 10  CD45 and MHC class I Mouse 0310 CCGATTGTAACAGAC

No Results Found. Please try a different search term.

We are glad to see that you are just as excited as we are to launch this new product line. As we build our portfolio of oligo conjugated antibodies we are collecting information regarding clone and target preferences so we can prioritize our pipeline. Please use this form to tell us about your oligo-antibody project. A BioLegend representative will contact you to discuss your request.
 

Your personal data will be handled according to our Privacy Policy. By submitting this request, you consent to being contacted by BioLegend so we may share the latest updates about products, services, promotions, and events. In addition, if you are located within a Distributor Territory, you may be contacted directly by them. We never sell your data to anyone. To view, edit or delete your preferences or personal information, please fill out our Privacy Request Form.

Login / Register
Forgot your password? Reset password?
Create an Account